More illustrations
authorKai Blin <kai@samba.org>
Sat, 14 Jan 2012 13:24:53 +0000 (00:24 +1100)
committerKai Blin <kai@samba.org>
Sat, 14 Jan 2012 13:24:53 +0000 (00:24 +1100)
12 files changed:
antismash_lca12.odp [new file with mode: 0644]
antismash_lca2011.html
antismash_talk.js
drawings/fight.odg [new file with mode: 0644]
fight.png [new file with mode: 0644]
gene_finding.svg [new file with mode: 0644]
languages_used.png [new file with mode: 0644]
script.txt
sequence_annotated.svg [new file with mode: 0644]
sequence_start_codons.svg [new file with mode: 0644]
sequence_stop_codons.svg [new file with mode: 0644]
sequence_unannotated.svg [new file with mode: 0644]

diff --git a/antismash_lca12.odp b/antismash_lca12.odp
new file mode 100644 (file)
index 0000000..68476c8
Binary files /dev/null and b/antismash_lca12.odp differ
index 935b7ac..66985c2 100644 (file)
   <h1>Biological Background</h2>
   </section>
 
+  <section class="slide" id="background-biotech">
+  <h1>Biotechnology</h1>
+  </section>
+
   <section class="slide" id="background-definition">
     <h2>Biotechnology - Definition</h2>
 
   <section class="slide" id="background-dna-double-helix">
     <img src="dna_animation_white.gif">
     <h3 class="centered">DNA double helix</h3>
-    </section>
+  </section>
 
   <section class="slide" id="background-amino-acids">
   <h2>Amino Acids</h2>
   <img src="antibiotics_locations_of_action.svg">
   </section>
 
+  <section class="slide" id="background-antibiotics-fight">
+  <img src="fight.png" height="600">
+  </section>
+
   <section class="slide" id="background-bioassay">
   <img src="antibiotics_screening_small.jpg">
   </section>
   <img src="antibiotic_resistance.svg">
   </section>
 
+  <section class="slide" id="background-central-dogma-exception">
+  <img src="central_dogma_exception.svg">
+  </section>
+
   <section class="slide" id="background-nrps">
   <h2>Non-Ribosomal Peptide Synthesis</h2>
   <img src="nrps.svg">
   <img src="antismash_logo.svg" height="550">
   </section>
 
+  <section class="slide" id="antismash-languages-used">
+    <h2>Languages Used</h2>
+    <img src="languages_used.png" height="550">
+  </section>
+
   <section class="slide" id="antismash-schema">
   <img src="server_architecture_old.png">
   </section>
 
   <section class="slide" id="antismash-gene-finding">
   <h2>Gene Finding</h2>
+  <img src="gene_finding.svg">
+  </section>
+
+  <section class="slide" id="antismash-find-orfs">
+  <h2>ORF Finding Example</h2>
+  <div id="orf-canvas"><img src="sequence_unannotated.svg"></div>
+  <div class="slide" id="antismash-find-orfs-start"></div>
+  <div class="slide" id="antismash-find-orfs-stop"></div>
+  <div class="slide" id="antismash-find-orfs-all"></div>
   </section>
 
   <section class="slide" id="antismash-cluster-identification">
index ae241ba..848e3ec 100644 (file)
@@ -34,6 +34,18 @@ $(function() {
     case "background-dna-double":
       $("#dna-canvas").html("<img src='dna_double_strand.svg'>");
       break;
+    case "antismash-find-orfs":
+      $("#orf-canvas").html("<img src='sequence_unannotated.svg'>");
+      break;
+    case "antismash-find-orfs-start":
+      $("#orf-canvas").html("<img src='sequence_start_codons.svg'>");
+      break;
+    case "antismash-find-orfs-stop":
+      $("#orf-canvas").html("<img src='sequence_stop_codons.svg'>");
+      break;
+    case "antismash-find-orfs-all":
+      $("#orf-canvas").html("<img src='sequence_annotated.svg'>");
+      break;
     }
   });
 });
diff --git a/drawings/fight.odg b/drawings/fight.odg
new file mode 100644 (file)
index 0000000..15ff350
Binary files /dev/null and b/drawings/fight.odg differ
diff --git a/fight.png b/fight.png
new file mode 100644 (file)
index 0000000..faeb56f
Binary files /dev/null and b/fight.png differ
diff --git a/gene_finding.svg b/gene_finding.svg
new file mode 100644 (file)
index 0000000..bce6d42
--- /dev/null
@@ -0,0 +1,369 @@
+<?xml version="1.0" encoding="UTF-8" standalone="no"?>
+<!-- Created with Inkscape (http://www.inkscape.org/) -->
+
+<svg
+   xmlns:dc="http://purl.org/dc/elements/1.1/"
+   xmlns:cc="http://creativecommons.org/ns#"
+   xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#"
+   xmlns:svg="http://www.w3.org/2000/svg"
+   xmlns="http://www.w3.org/2000/svg"
+   xmlns:sodipodi="http://sodipodi.sourceforge.net/DTD/sodipodi-0.dtd"
+   xmlns:inkscape="http://www.inkscape.org/namespaces/inkscape"
+   width="640"
+   height="480"
+   id="svg2"
+   version="1.1"
+   inkscape:version="0.47 r22583"
+   sodipodi:docname="New document 1">
+  <defs
+     id="defs4">
+    <inkscape:perspective
+       sodipodi:type="inkscape:persp3d"
+       inkscape:vp_x="0 : 526.18109 : 1"
+       inkscape:vp_y="0 : 1000 : 0"
+       inkscape:vp_z="744.09448 : 526.18109 : 1"
+       inkscape:persp3d-origin="372.04724 : 350.78739 : 1"
+       id="perspective10" />
+  </defs>
+  <sodipodi:namedview
+     id="base"
+     pagecolor="#ffffff"
+     bordercolor="#666666"
+     borderopacity="1.0"
+     inkscape:pageopacity="0.0"
+     inkscape:pageshadow="2"
+     inkscape:zoom="0.98994949"
+     inkscape:cx="404.80744"
+     inkscape:cy="320.56108"
+     inkscape:document-units="px"
+     inkscape:current-layer="layer1"
+     showgrid="false"
+     width="640px"
+     inkscape:window-width="1462"
+     inkscape:window-height="904"
+     inkscape:window-x="0"
+     inkscape:window-y="24"
+     inkscape:window-maximized="0" />
+  <metadata
+     id="metadata7">
+    <rdf:RDF>
+      <cc:Work
+         rdf:about="">
+        <dc:format>image/svg+xml</dc:format>
+        <dc:type
+           rdf:resource="http://purl.org/dc/dcmitype/StillImage" />
+        <dc:title></dc:title>
+      </cc:Work>
+    </rdf:RDF>
+  </metadata>
+  <g
+     inkscape:label="Layer 1"
+     inkscape:groupmode="layer"
+     id="layer1"
+     transform="translate(0,-572.36218)">
+    <text
+       xml:space="preserve"
+       style="font-size:22;font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;text-align:center;text-anchor:middle;fill:#000000;fill-opacity:1;stroke:none;font-family:DejaVu Sans;-inkscape-font-specification:DejaVu Sans"
+       x="15.152288"
+       y="12.299372"
+       id="text2816"
+       transform="translate(0,572.36218)"><tspan
+         sodipodi:role="line"
+         id="tspan2818"
+         x="15.152288"
+         y="12.299372"
+         style="font-size:22" /></text>
+    <text
+       xml:space="preserve"
+       style="font-size:12px;font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;text-align:start;text-anchor:start;fill:#000000;fill-opacity:1;stroke:none;font-family:DejaVu Sans;-inkscape-font-specification:DejaVu Sans"
+       x="-125.25892"
+       y="424.0473"
+       id="text3040"><tspan
+         sodipodi:role="line"
+         id="tspan3042"
+         x="-125.25892"
+         y="424.0473"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">&gt;AB070938 Streptomyces avermitilis melanin biosynthetic gene cluster.</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="439.0473"
+         id="tspan3044"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CTAGCAGCCCGCATCGCCCTCGACGTTGGCGATCATCGTGCGCAGCACCTTGAGCGCGGTCACGTACTCCTCGTCGCTGATGCCCTCGTGGACCACCGCGCGCAGCTCGGTCACCAGCTC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="454.0473"
+         id="tspan3046"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">ACGCAGCCGCTTCCTGGCAGCCTCCCCGGTGTCGGTGAGACGCAGGCGCTGTCCGGCGTCGATCCGAAGCCAGCCCCGGTGAAGCAGCTGGTCGACGACCCGCGCGATCTCGTGCGGCCC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="469.0473"
+         id="tspan3048"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GTCCGCGAGGGGCGTCAGCTGGGTGACCACCTCCTCCCGGCCCGGCGCCGCGGGCCCGCCGTGCACGCGGTTGAGCACCCAGTACTGCGGCTGTGTGACGTCGATCCTGGCCATGGCGTC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="484.0473"
+         id="tspan3050"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CCGCAGCTGCCGGGTGACCGCCGTGTGGGCCAGACCGCTCCAGTAGCCGATGGGCTGGGTGGCCAACACGTCGTCGGTGGCGGCCGGATCGGCCGGTGCCTGGTCGGTGGTGCTGCCGGT</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="499.0473"
+         id="tspan3052"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CAACGGTTTCATGATCGTGACGCTAGGTCCCCGTAGCGTGCGTGAACACCGTCGAACCAGGCAAGGTCTGGCCGAAACCTCCGCCCCTCCAGGTGGACCACCCCGTGCGGCGCGACCTTC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="514.0473"
+         id="tspan3054"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GTCCACGTCCCGACGCACGGTGATCGTGCTGGGGGCCAGCCCCTCCTGGAGGGCGTCGGCGGCGTCGGACCCGGGCCCGGAGCGCCCGGCGGAGCGTGGCATGATCGGGGGCATGTCTGA</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="529.0473"
+         id="tspan3056"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">ACGTGTGGTGGCCGCCTGTGACGGGGCGTCGAAGGGAAACCCCGGACCGGCCGGATGGGCCTGGGTCGTCGCCGACGGCGAGGAGACCCCGACCCGCTGGGCGGCCGGGGCGCTCGGCAC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="544.0473"
+         id="tspan3058"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GGCCACGAACAACGTGGCCGAACTCACCGCGCTGGAGCGCTTGTTGAGCGCGATGGATCCGGACGTCCCGCTGGAGATCCGGATGGACTCCCAGTACGCGATGAAGGCCGTCACGACCTG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="559.0473"
+         id="tspan3060"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GCTGCCCGGCTGGAAGCGCAAGGGCTGGAAGACGGCCGCGGGGAAGCCGGTCGCCAACCAGGAACTGGTCGCCCGCATCGACGAACTGCTCGACGGACGCTCCGTCGAGTTCCGTTACGT</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="574.0473"
+         id="tspan3062"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CCCCGCGCACCAGGTCGACGGCGACCGGCTCAACGACTTCGCCGACCGTGCCGCCAGCCAGGCGGCGATCGTCCAGGAACCGGCGGGCAGCGAGTACGGCTCCCCGGAGCCGCCGAAGTC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="589.0473"
+         id="tspan3064"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GCCCGACACCGTCGCGGCCGGCTCCGCGGGTCGCGGCGCTCCCGCCAAGAAGCGTGCCTCCGCGCGCACCGCCAAGACGAGCACGCGCACGATCAAGGCGAAGTTCCCCGGCCGCTGTGT</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="604.0473"
+         id="tspan3066"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CTGCGGCCGCCCCTACGCGGCGGGCGAGCCCATCGCCAAGAACGCGCAGGGCTGGGGCCACCCGGAGTGCCGTACCGCCGACGACGTCTAGGACCTCCCCGGCGGAGCATGCCCAAGGAC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="619.0473"
+         id="tspan3068"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GCGGGGGCTGACAGGCCGTGCGGCTTTTCCCGCCCGCCTGATCCGCCGGCCCTGGATCACGACCCCGGCGGCCTCCCACGAGTGGCCGCCGGGACCTCGAGCGCCTCGGCCGTCAGACGG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="634.0473"
+         id="tspan3070"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">TGTCGAACGTGTAGTGCGCGGTGTGGTCCAGCAGGTCCGCGGGGCGTACGTCGTTCCACGGCTTCATGGTCTCGTTCAGGTCGACGACGTTCGGCGTGCCGCCCGTCGGCACATAACCGG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="649.0473"
+         id="tspan3072"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">AGCCCGGGTGGCGGCTCTGCCACTGGGCCCAGAGCCTGTCGATGTAGGCGTGGTGGAGCCAGAAGACCGGGTCGTTGGGGGAGACCCCGGTGGCCATCTGGCCGCCGACCCAGACGTGGA</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="664.0473"
+         id="tspan3074"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CGCGGTTGTGCAGGTTCACACCGCGCCAGCCCTCGAGATGGTTGCGGAACCCGTCCGACGCGCTGTTCCACGGGGCCATGTCGTACGTGGACATCGCGAGCACGGAGTCGACCTCCGCCC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="679.0473"
+         id="tspan3076"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GGGTCGGCAGCTCGCGCCCGCCGCCGCCGAGCGTGCGCCGCAGATACGTACGGCTGTCGACCCGCACGTTGACCGGCCAGTTGCCGGTGGACGCCGCGAACGGCCCGTCCATCACCCGGC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="694.0473"
+         id="tspan3078"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CGTCCAGGCTGCGTCCGCTGCCGCCGAGGAAGTCGGGCGCCCACAGGGAGGCACGCGCCGTGCGGTCGGTGCTCCAGTCCCAGTACGGCAGCGCGACCGACGGGTCGACCGCCTGGAGCG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="709.0473"
+         id="tspan3080"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CCTGCTCGAACTCGATCAAAAATCTGCGGTGCCAGGGCAGGAAGGAAGGCGAACGATGGCCCGTGCGTTCGCCGCTGTCGGTGTCGCCCATGATGAAGGCGTTGTGGGTCGTGACGAACT</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="724.0473"
+         id="tspan3082"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CGGCCGTCAGGGTCGCCTGGTTCTTGCGTACGGTCATGTGCGGGTGACTCCAGAACTCTACGTGCGGGACGGTCAGTTGAAGGGGACGAGCGGCGCGCCCTGAAGCTCCACGACCGCGGC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="739.0473"
+         id="tspan3084"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GCGGGCGGCGGCGCGCGGGGTGGCCACGGGGTCGTAGTGGCTGACGACGCTGATCCAGCTGCCGTCGACGTTCTGCATCACGTGCAGTTCCATCCCGTCGATGAACACGCCGTACCCGGA</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="754.0473"
+         id="tspan3086"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GCCGTGGTGATGACCGCCCCCGGTCGCGCGGCCCTCTATTCGGCGCCCCTGATAGACCTCGTCGAACGGCTGGGGACCCCCGTGGTGCCCGGCCGCGGACGCGGACGGAGCGGCAAGGGC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="769.0473"
+         id="tspan3088"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CTGAGTGCCGGCCACGGCCGCCAGGGCGGCGGCGGCCCCGAGGGCATGACGGCGGGTGAGTTCGGGCATGCGAAGTCCTTCTGAGTCGAGGTGTGTTGACGACTCGGCATGCCTATCCGC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="784.0473"
+         id="tspan3090"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CCGGTCGGGAGCCGGAGAAATCGACGAAAACCGGTTGGCTACGATCCGGACAATTACCTACATGTCATACAGGATTGAACGAAGATGATCTTGCCGCCCCGGGTGGCCCACCCGGCGGCG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="799.0473"
+         id="tspan3092"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GAGGGGGAAGTTCCACCCCGGATCGGCGCCATCGCGGTGATCTTTTGCCGTCGATGCGGGGCGAGTGGTGCGGCTCACGTGCGCAGACTGGCGCGAACTGGCGCCTGCCCTCACCGCTCC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="814.0473"
+         id="tspan3094"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">AGGGGGTTCCCGCAGCGATTGCAGTAGCGGGCGTCGCTCTCCGTGGCCATACGTCCGCACTCGGCGCAGACCTGGTGCAGCAGGCATGCGGGCTCTCCGGTCGCCCCCGTCGTCGGCAGG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="829.0473"
+         id="tspan3096"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GCCGGGGGAGCGGCCGGACGGCGCGGGCGTACGGTCACGCAGTGCAGCCCCGCCTCCCCCGCGTGCAGCCGGTATCCAGCGGCGGGGGGCAGCCACACGGCGGCCGGGGGTGCCAACTCC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="844.0473"
+         id="tspan3098"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">AGCCATCCGCCCGGTGTCCGGAGCCGGCCGCCCCCGTCGAGGGCGATCACGAGGACGTCCCGCGAGCGGTCACCGGGCGGCTCGGCCGCCGCACCCGGCGGGATGTGCATCGCCTCGGCG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="859.0473"
+         id="tspan3100"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">TCGAGACCGGCGCCCGGCCGGTCCAGTCGCCAGTAGCGGCCCCCGGTCGCCCGGGAGACGAGTGCGGCCAGGACCGGGCCGGCGGGCGGATGCGTCACAGGGGCTCCTGTCGTCTGCGGC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="874.0473"
+         id="tspan3102"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GGGACGGGCCGCGATCGTACGACCGCCCCCGCCCGCCGCGCGGCGGAAGAGGCCGGGACGGTCGGTCTGCACGATGGCGCTGCTACCCTTCGTGGTCAATTGACCGCTTTGCGTAACATA</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="889.0473"
+         id="tspan3104"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GGGGAGTGCGCGTGAAGATCGCGTGCGTCGGCGGCGGACCCGCAAGCCTGTACTTCTCGATCCTGATGAAGCGCCAGGACCCGTCCCACGACATCACCGTCCACGAGCGGAACCCCGCCG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="904.0473"
+         id="tspan3106"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GATCGACCTACGGCTGGGGCGTGACCTACTGGAGCGGCCTGCTCGACAAACTCCGCGGGAGTGACCCCGAGTCGGCGCTCGCCGTCAGCGAGAACTCCGTCCGCTGGAGCGACGGAGTCG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="919.0473"
+         id="tspan3108"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CCCACGTCCGGAACCGCACCACGGTCCACCACGGCGACGAGGGCTTCGGCATCGGCCGCCGCAGATTCCTCGACGTACTGGCCGACCGGGCCCGGTCCCTGGGCGTCCGCATCGAGTACG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="934.0473"
+         id="tspan3110"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">AGCATGAGATCGGCGCCGACGACCCACTGCCCGAGGCCGATCTGGTCGTCGCCGGCGACGGGGTCAACAGCGTGCTGCGCGGCCGCTACGCCGACCACTTCGGCAGCGAGACCGTGCTCG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="949.0473"
+         id="tspan3112"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GCCGCAACCGCTACATCTGGCTCGGCACCACCAAGGTCTTCGACTCGTTCACCTTCGCCTTTGTGGAGAGCGAACACGGCTGGATCTGGTGCTACGGCTATGGATTCAGCGACGGCCACA</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="964.0473"
+         id="tspan3114"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GCACCTGCGTCATCGAGTGCTCCCCGGAAACCTGGACCGGGCTCGGCCTCGACCGGGCCAGCGAGGCCGACGGTCTCGCCCTGCTGGAGAAGCTCTTCGCCGACGTCCTCGACGGGCACG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="979.0473"
+         id="tspan3116"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">AGCTGATCGGCCGGGCGCAGAGCGACGGTGCCGCCCAGTGGCTGAACTTCCGCACCCTCACCAACCGCACCTGGCATCGCGACAACCTCGTCCTGATCGGCGACGCCGCCCACACCACCC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="994.0473"
+         id="tspan3118"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">ACTACTCCATCGGCGCGGGCACCACCCTCGCCCTGGAGGACGCCATCGCCCTCGCCGAAGCCCTGAGCGCGCACCGCGACCTGCCGGGCGCGCTCGCCGCCTACGAGCGGGAACGCAAGT</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1009.0473"
+         id="tspan3120"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CCGCGCTCCTGCACATCCAGAGCGCGGCCCGGCTCAGCGCCCAGTGGTACGAGAACCTCCCGCGCTACATCCGCCTTCCGCCCCCGCAGATGTTCGCCCTGCTCGGCCAGCGCCATTCCC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1024.0472"
+         id="tspan3122"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CGCTGCTGCCGTACGTGCCTCCGCAGCTCTACTACCGGATCGACCGGGCGGCCGGACAACTGGAGGCGCTGCGCAGGCTCAAGCGCTGGCTGGGGCCGCGACTGGCGCGTACCGTCCAGG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1039.0472"
+         id="tspan3124"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CGCGCACGGGCCGGTAGGCCGGCCGCCGGCGGCCGCGTCCGACGGAGAATTCTGGGTGAATGACCATTCACCCGGCTAAGGTGAATTCCTATTCACCTCCCTTCTTCACGTCGGCTGCCG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1054.0472"
+         id="tspan3126"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CCCCTGGAGTGACCATGGTCCCGATATCCACCCCGTCCGACCGGTCCGCGACCCCCGACGGACCGGCCGGACGGCCGGGTGTCCGCGACCGGCTGACGGTCCCCGTCCTGGCGTTCGGCG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1069.0472"
+         id="tspan3128"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GAATCCTCATGGCCGTCATGCAGACGGTCGTGGTGCCGCTGCTGCCCGACCTGCCGCGCCTGACCGGCGCTTCCGCGGGCGCCGTCTCCTGGATGGTCACCGCCACCCTGCTCTCCGGCG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1084.0472"
+         id="tspan3130"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CGGTGCTGACCCCGGTGCTCGGCCGGGCCGGCGACATGTACGGCAAGCGGCGGGTTCTGCTCGCCGCCCTCGCGCTGATGACCCTGGGCTCGCTGCTGTGCGCCGTCACCTCCGACATCC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1099.0472"
+         id="tspan3132"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GCGTGCTCATCGCCGCGCGGGCCCTCCAGGGCGCGGCGGCCGCCGTCGTACCGCTGTCGATCAGCATCCTGCGCGACGAACTCCCGCCCGAGCGCACGGGTTCCGCGGTGGCCCTGATGA</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1114.0472"
+         id="tspan3134"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GTTCCACCGTGGGCATCGGCGCCGCGCTCGGTCTGCCGATCGCCGCGATGATCGTGCAGTACGCCGACTGGCACGTCATGTTCTGGGCGACCACCGGGCTCGGCGCCGGCGGACTGGCAC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1129.0472"
+         id="tspan3136"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">TGGCGTGGTGGGCGGTGCGCGAGTCGCCCGTCCGGCAGCCGGGCCGCTTCGACACGCTGGGTGCGCTGGGGCTGGCCGCGGGCCTGGTCTGCCTGCTCCTCGGTGTGTCGCAGGGCGGGC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1144.0472"
+         id="tspan3138"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">AGTGGGGCTGGACCAGTCCGCGGATCGTCGGCCTGCTCGTGGCCTGCGTACTCGTACTGACGCTGTGGTGGTTCCAGCAGTGGCGGGCCCCGCGGCCCCTGGTGGACCTGAAGCTGGCCT</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1159.0472"
+         id="tspan3140"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CCCGCCCCCGGGTCGCCCTGCCGCACGTGGCCGCGCTGCTGACCGGATTCGCCTTCTACGGCAACTCGCTGGTCACGGCGCAGCTGGTGCAGGCGCCCAAGGCCACCGGCTACGGACTCG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1174.0472"
+         id="tspan3142"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GGCTGTCCATCGTGCAGACCGGTCTGTGCCTGCTGCCCGGCGGCGTCATCATGCTGCTGTTCTCGCCGGTCTCGGCGCGCATCTCGGCCGCCCGCGGCCCGCGCGTGACGCTGGCACTCG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1189.0472"
+         id="tspan3144"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">GGGCCGCGGTCATCGCCGTCGGCTACGCCGTGCGCATCGCGGACAGCCGCGACCTGTGGATGATCATCGTGGGCGCCACGGTCATCGCGGTCGGCACGACCCTCGCCTACTCGGCCCTGC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1204.0472"
+         id="tspan3146"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">CCACCCTGATCCTGCGTGCCGTGCCCGCCGGACAGACCGCCTCCGCCAACGGCGTCAACGTCCTGATGCGCACCATCGGCCAAGCCGTGTGCAGCGCGGCGGTCGCCGCCGTCCTGGTCC</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1219.0472"
+         id="tspan3148"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">ACCACACCAGCCTGGTGGGAGGCGCCCCGGTACCCACCCTGCACGGCTATCTGCTGGCGTTCGCGATGGCGGGTACGGTCGCAGTGATGGCCTGCGCCGCCGCCCTCGTCATCCCCGGGG</tspan><tspan
+         sodipodi:role="line"
+         x="-125.25892"
+         y="1234.0472"
+         id="tspan3150"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">ACCCCGACTCCCACGGCACGCGACGGGCCCGCGGCCGTACCCGGCCGTCCCACGACGAGGCGCTGGAAGGAGCATGA</tspan></text>
+    <text
+       xml:space="preserve"
+       style="font-size:144px;font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;text-align:center;text-anchor:middle;fill:#000000;fill-opacity:1;stroke:none;font-family:DejaVu Sans;-inkscape-font-specification:DejaVu Sans"
+       x="324.25897"
+       y="907.91034"
+       id="text3152"><tspan
+         sodipodi:role="line"
+         id="tspan3154"
+         x="324.25897"
+         y="907.91034"
+         style="font-size:260px;fill:#ff0000">?</tspan></text>
+  </g>
+</svg>
diff --git a/languages_used.png b/languages_used.png
new file mode 100644 (file)
index 0000000..8a3cd49
Binary files /dev/null and b/languages_used.png differ
index 3318426..83b65d8 100644 (file)
@@ -18,7 +18,7 @@ Tübingen, Germany. So, biotechnology, what is this all about?
 The United Nations "Convention on Biological Diversity" defines biotechnology
 as "Any technological application that uses biological systems, living
 organisms, or derivatives thereof, to make or modify products or processes for
-specific use". Quite a mouthful. But let me use a metaphor to build my
+specific use". Quite a mouthful. Let me use a metaphor to build my
 explanations on.
 
 In biotechnology, we use biological systems such as bacteria or yeast, and then
@@ -30,7 +30,7 @@ bacterium (Escherichia coli) to produce human insulin to treat people suffering
 from diabetes.
 
 Now, what's so nice about using those tiny organisms to produce these
-substances instead of going for an all-chemical full synthesis? Well, the first
+substances instead of going for an all-chemical synthesis? Well, the first
 is that in some cases, like yeast producing ethanol, nature has already built
 that functionality into the organism. It's much easier to just let the yeast do
 it's thing that it would be to do the synthesis from scratch.
@@ -98,7 +98,7 @@ maths. One letter can store four combinations. Two letters can store four to
 the power of two combinations, but that's sixteen, still not enough. So nature
 went for a three letter encoding, which gives us 64 combinations to work with.
 In biology those are called "codons". We only need 20 different codons, so
-we're good. Because it would be a shame to let the remaining 44 encodings go to
+we're good. Because it would be a shame to let the remaining 44 codons go to
 waste, multiple different codons encode the same ammino acid. This is called a
 "degenerate" code and adds even more protection against changes to DNA. The
 translations of codons into the corresponding amino acids often visualized in a
@@ -153,19 +153,18 @@ freshly tiled field. Because these bacteria are such important producers of
 antibiotics, we're focusing much of our work on them.
 
 How do antibiotics work anyway? If we look at how a cell works, there are a
-couple of key parts the cell absolutely requires to function. The cell wall,
-which the cell not only needs to keep all the other parts together but also
-because the electrical potential between the inside and the outside is how the
-cell powers itself. Many antibiotics target the cell wall integrity. The group
-of penicillin-like antibiotics is the most widespread here. Food additives like
-Nisin also target the cell wall of bacteria and poke holes into it. Also, if we
-remember the way the cell produces proteins, pretty much every step is the
-target of some antibiotic. Quinolones disrupt the enzymes that unwind the DNA
-for replication. Antibiotics like Rifampicin target the enzyme that makes the
-mRNA copies. Aminoglycoside antibiotics target the ribosomes and stop them from
-producing proteins. Sulfonamides inhibit some proteins in central metabolism
-pathways. Remember, running the metabolism means living, so if the metabolism
-stops, the cell dies.
+couple of key parts the cell absolutely requires to function. Apart from the
+metabolism steps, the most important part is the cell wall. The cell needs it to
+keep all the other parts together, after all.  Many antibiotics target the cell
+wall integrity. The group of penicillin-like antibiotics is the most widespread
+here. Food additives like Nisin also target the cell wall of bacteria and poke
+holes into it. If we remember the way the cell produces proteins, pretty
+much every step is the target of some antibiotic. Quinolones disrupt the
+enzymes that unwind the DNA for replication. Antibiotics like Rifampicin target
+the enzyme that makes the mRNA copies. Aminoglycoside antibiotics target the
+ribosomes and stop them from producing proteins. Sulfonamides inhibit some
+proteins in central metabolism pathways. Remember, running the metabolism means
+living, so if the metabolism stops, the cell dies.
 
 It would be very hard to come up with substances that hit all these diverse
 targets when starting a clean slate design. Fortunately, bacteria have been
@@ -257,10 +256,10 @@ teaching reflexes.
 
 antiSMASH, the antibiotics and secondary metabolites analysis shell, is a
 modular pipeline that uses a combination of new and exsiting bioinformatics
-tools to search genomes related to secondary metabolite gene clusters. It's a
-cooperation project between the University of Tübingen, Germany, the University
-of Groningen, Netherlands, and the University of California San Francisco in
-the United States.
+tools to search genomes for gene clusters related to secondary metabolites.
+It's a cooperation project between the University of Tübingen, Germany, the
+University of Groningen, Netherlands, and the University of California San
+Francisco in the United States.
 
 The main pipeline code is written in Python, but we have a fair share of Perl
 code, Java GUI code, and the web front-end was just migrated off PHP to
@@ -274,13 +273,36 @@ happens. I'll follow the way of a submitted gene sequence through the pipeline,
 explaining what's going on at every step.
 
 If we don't know anything about the submitted sequence, we start with a gene
-identification step. Here we start with identifying possible genes. The exact
-process is a bit complicated, but it's basically a fancy way of doing the
-following: Look for a start tag (ATG or GTG) and then look for a stop codon
-downstream. Now, take all those hits and combine them in a way that gives you
-the maximal number of long genes. This heuristic turns out to work well for the
-data we're seeing.
+identification step. Here we start with identifying possible open reading
+frames. An open reading frame is something that looks like a gene, but hasn't
+been confirmed to produce anything experimentally. We call this an open reading
+frame because a ribosome could read in 3-letter steps from a start codon, to a
+stop codon later in the sequence. The exact process is a bit complicated, but
+it's basically a fancy way of doing the following: Look for a start tag (ATG or
+GTG) and then look for a stop codon downstream. Now, take all those hits and
+combine them in a way that gives you the maximal number of long genes. This
+heuristic turns out to work well for the data we're seeing.
+
+We tried a couple of implementations for this to optimize for speed and
+accuracy, but in the end we settled for using the preexisting "Glimmer" tool.
 
 Now that we've found genes, we need to identify interesting gene clusters, that
 is, gene clusters related to secondary metabolites. We do this by building up
 profiles of known examples of secondary metabolite genes.
+
+Now that we've identified interesting gene clusters, we compare them gene by
+gene with other know secondary metabolite clusters.
+
+NRPSpredictor...
+
+FastTree/smCoGs
+
+Smiles/structure prediction
+
+svg/web site generation
+
+full genmome hmmer/blast
+
+fischbach method
+
+web frontend...
diff --git a/sequence_annotated.svg b/sequence_annotated.svg
new file mode 100644 (file)
index 0000000..8b7809b
--- /dev/null
@@ -0,0 +1,176 @@
+<?xml version="1.0" encoding="UTF-8" standalone="no"?>
+<!-- Created with Inkscape (http://www.inkscape.org/) -->
+
+<svg
+   xmlns:dc="http://purl.org/dc/elements/1.1/"
+   xmlns:cc="http://creativecommons.org/ns#"
+   xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#"
+   xmlns:svg="http://www.w3.org/2000/svg"
+   xmlns="http://www.w3.org/2000/svg"
+   xmlns:sodipodi="http://sodipodi.sourceforge.net/DTD/sodipodi-0.dtd"
+   xmlns:inkscape="http://www.inkscape.org/namespaces/inkscape"
+   width="735.33984"
+   height="168.15234"
+   id="svg3177"
+   version="1.1"
+   inkscape:version="0.47 r22583"
+   sodipodi:docname="sequence_annotated.svg">
+  <defs
+     id="defs3179">
+    <inkscape:perspective
+       sodipodi:type="inkscape:persp3d"
+       inkscape:vp_x="0 : 300 : 1"
+       inkscape:vp_y="0 : 1000 : 0"
+       inkscape:vp_z="800 : 300 : 1"
+       inkscape:persp3d-origin="400 : 200 : 1"
+       id="perspective3185" />
+  </defs>
+  <sodipodi:namedview
+     id="base"
+     pagecolor="#ffffff"
+     bordercolor="#666666"
+     borderopacity="1.0"
+     inkscape:pageopacity="0.0"
+     inkscape:pageshadow="2"
+     inkscape:zoom="0.84852814"
+     inkscape:cx="440.6964"
+     inkscape:cy="-43.55698"
+     inkscape:current-layer="layer1"
+     inkscape:document-units="px"
+     showgrid="false"
+     inkscape:window-width="1478"
+     inkscape:window-height="883"
+     inkscape:window-x="200"
+     inkscape:window-y="111"
+     inkscape:window-maximized="0" />
+  <metadata
+     id="metadata3182">
+    <rdf:RDF>
+      <cc:Work
+         rdf:about="">
+        <dc:format>image/svg+xml</dc:format>
+        <dc:type
+           rdf:resource="http://purl.org/dc/dcmitype/StillImage" />
+        <dc:title />
+      </cc:Work>
+    </rdf:RDF>
+  </metadata>
+  <g
+     id="layer1"
+     inkscape:label="Layer 1"
+     inkscape:groupmode="layer"
+     transform="translate(-16.103625,-34.593586)">
+    <text
+       xml:space="preserve"
+       style="font-size:24px;font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;text-align:start;text-anchor:start;fill:#000000;fill-opacity:1;stroke:none;font-family:DejaVu Sans;-inkscape-font-specification:DejaVu Sans"
+       x="15.670032"
+       y="52.406086"
+       id="text3187"><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="52.406086"
+         id="tspan3193"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">TGTTAGGT<tspan
+   style="fill:#00ff7f"
+   id="tspan3239">ATG</tspan><tspan
+   style="fill:#87ceeb"
+   id="tspan3338">CCG<tspan
+   style="fill:#4682b4"
+   id="tspan3340">ACG</tspan>AGG<tspan
+   style="fill:#4682b4"
+   id="tspan3342">TCC</tspan>CGC</tspan><tspan
+   style="fill:#ff4500"
+   id="tspan3326">TGA</tspan>GGT<tspan
+   style="fill:#ff4500"
+   id="tspan3328">TAG</tspan>CAAA<tspan
+   style="fill:#ff4500"
+   id="tspan3330">TAG</tspan>AGGGGGAGT</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="82.406082"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3208">CCACCCCGGATCGGCGCCATCGCG<tspan
+   style="fill:#00ff7f"
+   id="tspan3241">GTG</tspan><tspan
+   style="fill:#87ceeb"
+   id="tspan3344">ATC<tspan
+   style="fill:#4682b4"
+   id="tspan3350">TTT</tspan>TGC<tspan
+   style="fill:#4682b4"
+   id="tspan3352">CGT</tspan>CGA<tspan
+   style="fill:#4682b4"
+   id="tspan3354">TGC</tspan>GGG<tspan
+   style="fill:#4682b4"
+   id="tspan3356">GCG</tspan></tspan></tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="112.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#87ceeb;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3210">AGT<tspan
+   style="fill:#4682b4"
+   id="tspan3358">GGT</tspan>GCG<tspan
+   style="fill:#4682b4"
+   id="tspan3360">GCT</tspan>CAC<tspan
+   style="fill:#4682b4"
+   id="tspan3362">GTG</tspan>CGC<tspan
+   style="fill:#4682b4"
+   id="tspan3364">AGA</tspan>CTG<tspan
+   style="fill:#4682b4"
+   id="tspan3366">GCG</tspan>CGA<tspan
+   style="fill:#4682b4"
+   id="tspan3368">ACT</tspan>GGC<tspan
+   style="fill:#4682b4"
+   id="tspan3370">GCC</tspan>TGC<tspan
+   style="fill:#4682b4"
+   id="tspan3372">CCT</tspan>CAC</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="142.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3212"><tspan
+   style="fill:#87ceeb"
+   id="tspan3348"><tspan
+   style="fill:#4682b4"
+   id="tspan3374">CGC</tspan>TCC<tspan
+   style="fill:#4682b4"
+   id="tspan3376">AGG</tspan>GGG<tspan
+   style="fill:#4682b4"
+   id="tspan3378">TTC</tspan>CCG<tspan
+   style="fill:#4682b4"
+   id="tspan3380">CAG</tspan>CGA<tspan
+   style="fill:#4682b4"
+   id="tspan3382">TTG</tspan>CA</tspan><tspan
+   style="fill:#ff4500"
+   id="tspan3332">TAG</tspan>CGGGGCGTCGCTCTCC<tspan
+   style="fill:#00ff7f"
+   id="tspan3249">GTG</tspan></tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="172.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3214">GCCATACGTCCGCACTCGGCGCAGACCTG<tspan
+   style="fill:#00ff7f"
+   id="tspan3251">GTG</tspan>CAGCAGGC<tspan
+   style="fill:#00ff7f"
+   id="tspan3253">ATG</tspan>CGGGCTCT</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="202.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3216">CCGGTCGCCCCCGTCGTCGG<tspan
+   style="fill:#ff4500"
+   id="tspan3334">TAG</tspan>GGCCGGGG<tspan
+   style="fill:#ff4500"
+   id="tspan3336">TAA</tspan>CGGCCG</tspan></text>
+    <flowRoot
+       xml:space="preserve"
+       id="flowRoot3200"
+       style="font-size:24px;font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;text-align:center;text-anchor:middle;fill:#000000;fill-opacity:1;stroke:none;font-family:DejaVu Sans;-inkscape-font-specification:DejaVu Sans"><flowRegion
+         id="flowRegion3202"><rect
+           id="rect3204"
+           width="110.78006"
+           height="192.09734"
+           x="4889.6436"
+           y="50.813732" /></flowRegion><flowPara
+         id="flowPara3206" /></flowRoot>  </g>
+</svg>
diff --git a/sequence_start_codons.svg b/sequence_start_codons.svg
new file mode 100644 (file)
index 0000000..6451ec9
--- /dev/null
@@ -0,0 +1,126 @@
+<?xml version="1.0" encoding="UTF-8" standalone="no"?>
+<!-- Created with Inkscape (http://www.inkscape.org/) -->
+
+<svg
+   xmlns:dc="http://purl.org/dc/elements/1.1/"
+   xmlns:cc="http://creativecommons.org/ns#"
+   xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#"
+   xmlns:svg="http://www.w3.org/2000/svg"
+   xmlns="http://www.w3.org/2000/svg"
+   xmlns:sodipodi="http://sodipodi.sourceforge.net/DTD/sodipodi-0.dtd"
+   xmlns:inkscape="http://www.inkscape.org/namespaces/inkscape"
+   width="735.33984"
+   height="168.15234"
+   id="svg3177"
+   version="1.1"
+   inkscape:version="0.47 r22583"
+   sodipodi:docname="sequence_start_codons.svg">
+  <defs
+     id="defs3179">
+    <inkscape:perspective
+       sodipodi:type="inkscape:persp3d"
+       inkscape:vp_x="0 : 300 : 1"
+       inkscape:vp_y="0 : 1000 : 0"
+       inkscape:vp_z="800 : 300 : 1"
+       inkscape:persp3d-origin="400 : 200 : 1"
+       id="perspective3185" />
+  </defs>
+  <sodipodi:namedview
+     id="base"
+     pagecolor="#ffffff"
+     bordercolor="#666666"
+     borderopacity="1.0"
+     inkscape:pageopacity="0.0"
+     inkscape:pageshadow="2"
+     inkscape:zoom="0.84852814"
+     inkscape:cx="440.6964"
+     inkscape:cy="-43.55698"
+     inkscape:current-layer="layer1"
+     inkscape:document-units="px"
+     showgrid="false"
+     inkscape:window-width="1478"
+     inkscape:window-height="883"
+     inkscape:window-x="200"
+     inkscape:window-y="111"
+     inkscape:window-maximized="0" />
+  <metadata
+     id="metadata3182">
+    <rdf:RDF>
+      <cc:Work
+         rdf:about="">
+        <dc:format>image/svg+xml</dc:format>
+        <dc:type
+           rdf:resource="http://purl.org/dc/dcmitype/StillImage" />
+        <dc:title />
+      </cc:Work>
+    </rdf:RDF>
+  </metadata>
+  <g
+     id="layer1"
+     inkscape:label="Layer 1"
+     inkscape:groupmode="layer"
+     transform="translate(-16.103625,-34.593586)">
+    <text
+       xml:space="preserve"
+       style="font-size:24px;font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;text-align:start;text-anchor:start;fill:#000000;fill-opacity:1;stroke:none;font-family:DejaVu Sans;-inkscape-font-specification:DejaVu Sans"
+       x="15.670032"
+       y="52.406086"
+       id="text3187"><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="52.406086"
+         id="tspan3193"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">TGTTAGGT<tspan
+   style="fill:#00ff7f"
+   id="tspan3447">ATG</tspan>CCGACGAGGTCCCGCTGAGGTTAGCAAATAGAGGGGGAGT</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="82.406082"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3208">CCACCCCGGATCGGCGCCATCGCG<tspan
+   style="fill:#00ff7f"
+   id="tspan3449">GTG</tspan>ATCTTTTGCCGTCG<tspan
+   style="fill:#00ff7f"
+   id="tspan3451">ATG</tspan>CGGGGCG</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="112.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3210">A<tspan
+   style="fill:#00ff7f"
+   id="tspan3453">GTGGTG</tspan>CGGCTCAC<tspan
+   style="fill:#00ff7f"
+   id="tspan3455">GTG</tspan>CGCAGACTGGCGCGAACTGGCGCCTGCCCTCAC</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="142.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3212">CGCTCCAGGGGGTTCCCGCAGCGATTGCAGTAGGGGGCGTCGCTCTCC<tspan
+   style="fill:#00ff7f"
+   id="tspan3457">GTG</tspan></tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="172.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3214">GCCATACGTCCGCACTCGGCGCAGACCTG<tspan
+   style="fill:#00ff7f"
+   id="tspan3459">GTG</tspan>CAGCAGGC<tspan
+   style="fill:#00ff7f"
+   id="tspan3461">ATG</tspan>CGGGCTCT</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="202.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3216">CCGGTCGCCCCCGTCGTCGGTAGGGCCGGGGTAACGGCCG</tspan></text>
+    <flowRoot
+       xml:space="preserve"
+       id="flowRoot3200"
+       style="font-size:24px;font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;text-align:center;text-anchor:middle;fill:#000000;fill-opacity:1;stroke:none;font-family:DejaVu Sans;-inkscape-font-specification:DejaVu Sans"><flowRegion
+         id="flowRegion3202"><rect
+           id="rect3204"
+           width="110.78006"
+           height="192.09734"
+           x="4889.6436"
+           y="50.813732" /></flowRegion><flowPara
+         id="flowPara3206" /></flowRoot>  </g>
+</svg>
diff --git a/sequence_stop_codons.svg b/sequence_stop_codons.svg
new file mode 100644 (file)
index 0000000..e191bf4
--- /dev/null
@@ -0,0 +1,138 @@
+<?xml version="1.0" encoding="UTF-8" standalone="no"?>
+<!-- Created with Inkscape (http://www.inkscape.org/) -->
+
+<svg
+   xmlns:dc="http://purl.org/dc/elements/1.1/"
+   xmlns:cc="http://creativecommons.org/ns#"
+   xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#"
+   xmlns:svg="http://www.w3.org/2000/svg"
+   xmlns="http://www.w3.org/2000/svg"
+   xmlns:sodipodi="http://sodipodi.sourceforge.net/DTD/sodipodi-0.dtd"
+   xmlns:inkscape="http://www.inkscape.org/namespaces/inkscape"
+   width="735.33984"
+   height="168.15234"
+   id="svg3177"
+   version="1.1"
+   inkscape:version="0.47 r22583"
+   sodipodi:docname="sequence_stop_codons.svg">
+  <defs
+     id="defs3179">
+    <inkscape:perspective
+       sodipodi:type="inkscape:persp3d"
+       inkscape:vp_x="0 : 300 : 1"
+       inkscape:vp_y="0 : 1000 : 0"
+       inkscape:vp_z="800 : 300 : 1"
+       inkscape:persp3d-origin="400 : 200 : 1"
+       id="perspective3185" />
+  </defs>
+  <sodipodi:namedview
+     id="base"
+     pagecolor="#ffffff"
+     bordercolor="#666666"
+     borderopacity="1.0"
+     inkscape:pageopacity="0.0"
+     inkscape:pageshadow="2"
+     inkscape:zoom="0.84852814"
+     inkscape:cx="440.69641"
+     inkscape:cy="-43.55698"
+     inkscape:current-layer="layer1"
+     inkscape:document-units="px"
+     showgrid="false"
+     inkscape:window-width="1478"
+     inkscape:window-height="883"
+     inkscape:window-x="200"
+     inkscape:window-y="111"
+     inkscape:window-maximized="0" />
+  <metadata
+     id="metadata3182">
+    <rdf:RDF>
+      <cc:Work
+         rdf:about="">
+        <dc:format>image/svg+xml</dc:format>
+        <dc:type
+           rdf:resource="http://purl.org/dc/dcmitype/StillImage" />
+        <dc:title></dc:title>
+      </cc:Work>
+    </rdf:RDF>
+  </metadata>
+  <g
+     id="layer1"
+     inkscape:label="Layer 1"
+     inkscape:groupmode="layer"
+     transform="translate(-16.103625,-34.593586)">
+    <text
+       xml:space="preserve"
+       style="font-size:24px;font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;text-align:start;text-anchor:start;fill:#000000;fill-opacity:1;stroke:none;font-family:DejaVu Sans;-inkscape-font-specification:DejaVu Sans"
+       x="15.670032"
+       y="52.406086"
+       id="text3187"><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="52.406086"
+         id="tspan3193"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">TGTTAGGT<tspan
+   style="fill:#00ff7f"
+   id="tspan3447">ATG</tspan>CCGACGAGGTCCCGC<tspan
+   style="fill:#ff4500"
+   id="tspan3509">TGA</tspan>GGT<tspan
+   style="fill:#ff4500"
+   id="tspan3513">TAG</tspan>CAAA<tspan
+   style="fill:#ff4500"
+   id="tspan3511">TAG</tspan>AGGGGGAGT</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="82.406082"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3208">CCACCCCGGATCGGCGCCATCGCG<tspan
+   style="fill:#00ff7f"
+   id="tspan3449">GTG</tspan>ATCTTTTGCCGTCG<tspan
+   style="fill:#00ff7f"
+   id="tspan3451">ATG</tspan>CGGGGCG</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="112.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3210">A<tspan
+   style="fill:#00ff7f"
+   id="tspan3453">GTGGTG</tspan>CGGCTCAC<tspan
+   style="fill:#00ff7f"
+   id="tspan3455">GTG</tspan>CGCAGACTGGCGCGAACTGGCGCCTGCCCTCAC</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="142.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3212">CGCTCCAGGGGGTTCCCGCAGCGATTGCAG<tspan
+   style="fill:#ff4500"
+   id="tspan3515">TAG</tspan>GGGGCGTCGCTCTCC<tspan
+   style="fill:#00ff7f"
+   id="tspan3457">GTG</tspan></tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="172.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3214">GCCATACGTCCGCACTCGGCGCAGACCTG<tspan
+   style="fill:#00ff7f"
+   id="tspan3459">GTG</tspan>CAGCAGGC<tspan
+   style="fill:#00ff7f"
+   id="tspan3461">ATG</tspan>CGGGCTCT</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="202.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3216">CCGGTCGCCCCCGTCGTCGG<tspan
+   style="fill:#ff4500"
+   id="tspan3517">TAG</tspan>GGCCGGGG<tspan
+   style="fill:#ff4500"
+   id="tspan3519">TAA</tspan>CGGCCG</tspan></text>
+    <flowRoot
+       xml:space="preserve"
+       id="flowRoot3200"
+       style="font-size:24px;font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;text-align:center;text-anchor:middle;fill:#000000;fill-opacity:1;stroke:none;font-family:DejaVu Sans;-inkscape-font-specification:DejaVu Sans"><flowRegion
+         id="flowRegion3202"><rect
+           id="rect3204"
+           width="110.78006"
+           height="192.09734"
+           x="4889.6436"
+           y="50.813732" /></flowRegion><flowPara
+         id="flowPara3206"></flowPara></flowRoot>  </g>
+</svg>
diff --git a/sequence_unannotated.svg b/sequence_unannotated.svg
new file mode 100644 (file)
index 0000000..d74bf7a
--- /dev/null
@@ -0,0 +1,110 @@
+<?xml version="1.0" encoding="UTF-8" standalone="no"?>
+<!-- Created with Inkscape (http://www.inkscape.org/) -->
+
+<svg
+   xmlns:dc="http://purl.org/dc/elements/1.1/"
+   xmlns:cc="http://creativecommons.org/ns#"
+   xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#"
+   xmlns:svg="http://www.w3.org/2000/svg"
+   xmlns="http://www.w3.org/2000/svg"
+   xmlns:sodipodi="http://sodipodi.sourceforge.net/DTD/sodipodi-0.dtd"
+   xmlns:inkscape="http://www.inkscape.org/namespaces/inkscape"
+   width="735.33984"
+   height="168.15234"
+   id="svg3177"
+   version="1.1"
+   inkscape:version="0.47 r22583"
+   sodipodi:docname="sequence_unannotated.svg">
+  <defs
+     id="defs3179">
+    <inkscape:perspective
+       sodipodi:type="inkscape:persp3d"
+       inkscape:vp_x="0 : 300 : 1"
+       inkscape:vp_y="0 : 1000 : 0"
+       inkscape:vp_z="800 : 300 : 1"
+       inkscape:persp3d-origin="400 : 200 : 1"
+       id="perspective3185" />
+  </defs>
+  <sodipodi:namedview
+     id="base"
+     pagecolor="#ffffff"
+     bordercolor="#666666"
+     borderopacity="1.0"
+     inkscape:pageopacity="0.0"
+     inkscape:pageshadow="2"
+     inkscape:zoom="0.84852814"
+     inkscape:cx="292.79324"
+     inkscape:cy="-43.55698"
+     inkscape:current-layer="layer1"
+     inkscape:document-units="px"
+     showgrid="false"
+     inkscape:window-width="1478"
+     inkscape:window-height="883"
+     inkscape:window-x="200"
+     inkscape:window-y="111"
+     inkscape:window-maximized="0" />
+  <metadata
+     id="metadata3182">
+    <rdf:RDF>
+      <cc:Work
+         rdf:about="">
+        <dc:format>image/svg+xml</dc:format>
+        <dc:type
+           rdf:resource="http://purl.org/dc/dcmitype/StillImage" />
+        <dc:title />
+      </cc:Work>
+    </rdf:RDF>
+  </metadata>
+  <g
+     id="layer1"
+     inkscape:label="Layer 1"
+     inkscape:groupmode="layer"
+     transform="translate(-16.103625,-34.593586)">
+    <text
+       xml:space="preserve"
+       style="font-size:24px;font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;text-align:start;text-anchor:start;fill:#000000;fill-opacity:1;stroke:none;font-family:DejaVu Sans;-inkscape-font-specification:DejaVu Sans"
+       x="15.670032"
+       y="52.406086"
+       id="text3187"><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="52.406086"
+         id="tspan3193"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono">TGTTAGGTATGCCGACGAGGTCCCGCTGAGGTTAGCAAATAGAGGGGGAGT</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="82.406082"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3208">CCACCCCGGATCGGCGCCATCGCGGTGATCTTTTGCCGTCGATGCGGGGCG</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="112.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3210">AGTGGTGCGGCTCACGTGCGCAGACTGGCGCGAACTGGCGCCTGCCCTCAC</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="142.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3212">CGCTCCAGGGGGTTCCCGCAGCGATTGCAGTAGGGGGCGTCGCTCTCCGTG</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="172.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3214">GCCATACGTCCGCACTCGGCGCAGACCTGGTGCAGCAGGCATGCGGGCTCT</tspan><tspan
+         sodipodi:role="line"
+         x="15.670032"
+         y="202.40608"
+         style="font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;fill:#000000;font-family:DejaVu Sans Mono;-inkscape-font-specification:DejaVu Sans Mono"
+         id="tspan3216">CCGGTCGCCCCCGTCGTCGGTAGGGCCGGGGTAACGGCCG</tspan></text>
+    <flowRoot
+       xml:space="preserve"
+       id="flowRoot3200"
+       style="font-size:24px;font-style:normal;font-variant:normal;font-weight:normal;font-stretch:normal;text-align:center;text-anchor:middle;fill:#000000;fill-opacity:1;stroke:none;font-family:DejaVu Sans;-inkscape-font-specification:DejaVu Sans"><flowRegion
+         id="flowRegion3202"><rect
+           id="rect3204"
+           width="110.78006"
+           height="192.09734"
+           x="4889.6436"
+           y="50.813732" /></flowRegion><flowPara
+         id="flowPara3206" /></flowRoot>  </g>
+</svg>